AN_16SMetagenomics

Explore the microbial community composition of your samples Compare taxonomic shifts within a given experimental setup Introduction Microbial communities are present in almost every environment. They are important drivers of biogeochemical processes, have a large influence on human health and harbor enormous potential for biotechnological applica - tions. A major goal in the analysis of a microbial community is to identify its taxonomic composition and diversity. Sequencing of the ribosomal RNA (rRNA) gene and its internal spacer regions has become the gold standard for the identi - fication of microorganisms such as bac - teria, archaea and fungi. Its presence in all living organism, the combination of conserved and hypervariable genetic regions and the availability of curated reference databases make the rRNA gene an ideal phylogenetic marker. The com - bination of next generation sequencing (NGS) of partial regions of the rRNA gene combined with adequate bioinformatics analysis is a powerful tool to explore the composition of microbial communities. Amplicon Metagenomics – 16S/ITS Choice of the Primer System Amplicon metagenomics is based on NGS sequencing of the microbial rRNA gene. Since NGS read lengths are limited, only parts of the rRNA gene can be amplified and sequenced. For prokaryotes, the analysis targets hyper - variable regions (V1-9) on the 16S rRNA gene, while for fungi the internal tran - scribed spacer regions (ITS) are used for taxonomic profiling (see Figure 1 ). An ideal primer system should be uni - versal enough to cover a broad range of taxonomic groups, while the result - ing amplicon must provide enough tax - onomic information for a reliable tax - onomic classification. Based on our experience and the validation of our 16S/ITS analysis pipeline, we recom - mend the primer systems displayed in Table 1 . Our service is not restricted to the displayed marker genes and primer systems, also other phyloge - netic marker genes (e.g. cytochrome c oxidase I) and primer systems can be used. A pilot study can be very helpful to find the best primer system for your specific research question. Figure 1. Overview of loci of ribosomal gene loci commonly used for the taxonomic analysis of microbial communities. Hypervariable regions are marked in green while conserved regions are marked in grey. A. Structure of the prokaryotic 16S rRNA gene showing the nine hypervariable regions (V1-V9) and the regions targeted by the commonly used primer systems. B. Organization of the fungal rRNA gene operon showing two internal transcribed spacer regions (ITS). ITS2 is most often used for profiling fungal communities. Primer Name Sequence (5’-3’) Region Size (bp) Source 515F (Parada) 806R (Apprill) GTGYCAGCMGCCGCGGTAA GGACTACNVGGGTWTCTAAT V4 ~300 [1] 341F 805R CCTACGGGNGGCWGCAG GACTACHVGGGTATCTAATCC V34 ~460 [2] ITS3 ITS4 GCATCGATGAAGAACGCAGC TCC TCCGC T TAT TGATATGC ITS2 300-400 [3] Table 1. Recommended and commonly used universal primer systems for prokaryotic (515F/806R, 341Fl/805R) and fungal (ITS3/ITS4) microbiome profiling. Only template specific sequences are shown. For Illumina-Sequencing the primer sequences must be combined with Illumina adaptor sequences in a two-step PCR approach. For further information consult our application note for Amplicon Deep Sequencing (https:// www.microsynth.ch/amplicon-deep-sequencing.html). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Microsynth Competences and Services Microbial community profiling is one of Microsynth’s core competences. Based on our extensive experience, we provide a one-stop service from experimental design to bioinformatics analysis (see Figure 2 ). You can either outsource the whole process or only single steps to us. We validated our whole amplicon metagenomics pipeline and the includ - ing methods by sequencing and analysis of two well characterized mock commu - nities. For further information on our val - idation process and possibilities to vali - date your own study, please contact us. Experimental Design The gain and impact of a study is highly dependent on its experimental design. The use of replicates, controls and appro - priate sampling methods are only a few examples of important points to con - sider. Make use of our experience; our NGS specialists will assist you from the start. DNA Isolation Microorganisms are highly diverse regarding their physiology and are often associated with surfaces like soil particles or are organized in stable agglomera - tions such as biofilms. DNA extraction of complex matrices is challenging. You can either perform the extraction yourself or outsource this critical step. Microsynth has extensive experience in DNA and RNA isolation from various matrices (e.g. soil or feces). PCR Amplification PCR amplification follows a two-step protocol. In a first step the locus-specific sequence is amplified, while in a second step the Illumina sequencing adaptors and indices are added. For projects with very low amounts of starting material we recommend our three-step PCR protocol including two subsequent locus-specific PCRs to increase the yield of sequence- able amplicons. NGS Sequencing Sequencing is performed on the Illumina MiSeq system. The MiSeq allows high throughput profiling at low cost, sup - porting read lengths up to 2x300 bp. Bioinformatics Analysis Microsynth’s amplicon metagenomics analysis is based on up-to-date and pub - lished bioinformatics software such as USEARCH [4] to get meaningful and relia - ble results for your sequencing data. 16S/ ITS analysis includes extensive quality fil - tering, denoising of operational taxo - nomic units (OTU), taxonomic classifi - cation based on various databases and alpha diversity analysis (i.e. OTU diver - sity within a given sample). Depending on the aim of the study and the exper - imental design (conditions, replicates), Microsynth also offers a complementary module for comparative statistics. This module includes beta diversity analysis (i.e. OTU diversity across samples) and determination of differentially abun - dant OTUs including appropriate statis - tical measures. The results are presented in an interactive and understandable format, including guidance through the results by our bioinformatics experts. Figure 2. Microsynths workflow for amplicon metagenomics projects. The workflow can be entered and exited at various steps dependent on the customers' requirements. Example Results of the 16S/ITS Analysis Microsynth’s analysis pipeline provides you with a full characterization of the microbial communities in your samples. Alpha diversity measures provide an overview on OTU richness and diversity within the samples (see Figure 3 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Figure 3 . Examples for alpha diversity results. 3A. Rarefaction curves indicating whether sampling and sequencing covered the sample richness. 3B. Alpha diversity measures for the analyzed community including observed richness, Chao 1 indices representing the estimated richness and the Shannon diversity indices.
               
     

 
        !   " " " " " " " "  !#$%  #
 #&  #'  #(  #)  #* %  + ,   " +-   !#  !#.  !

*/&
*/)
*/(
0/) &/'
/1 2  "   23    3    3 ' *
1/0  !
0& / &/&
0/1
'/

/'
&/*2 "  2  2 2   #
2  ' &)
*/&  !&
)/1
)/)
)/1
)/
(/

)/' 2  "   22    +    +  ' )
)/&  !'
&/)
&/(
&/

(/)
)/
(/ 2     -      4    4       & 1&
' /*  !(
'/1
'/*
'/'
&/
&/(

/) 2  "   2 2  3    3  &)* 
&/  !) 0/
& 0/(
0/**

/)
&/

/)2   -   4    4     4     &

 
/)  !* */1 */
0 */((/*)0/&(0/'12     -             
)' 1 /*(  !1 */* */&0 */))/0
)/11*/&)2  "   23    4     4   
&) */&( Table 2. This detail of a sortable results table lists relative abundances and taxonomic identification of observed OTUs in the different samples. For taxonomic classi - fication confidence values are calculated and OTUs are only classified up to a specific rank if its confidence value is above a preset threshold to avoid dubious classifi - cations and false-positive results.
























          


















   


















            
    ! " 

  # Various reference databases are avail - able for the taxonomic classification of OTUs. Classifications are only shown to the taxonomic level, where the classi - fication fulfills certain confidence cri - teria in order to prevent false positive results. All observed OTUs are displayed together with their taxonomy and the relative abundance within the samples (see Table 2 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing References [1] https://earthmicrobiome.org/protocols-and-standards/16s/, accessed June 2021 [2] Klindworth et al. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies, Nucleic Acid Res, 41, e1. [3] White et al. (1990) Amplification and sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR protocols. A guide to methods and applications, San Diego, Academic Press Inc., 315–322. [4] Edgar (2016) UNOISE2: Improved error-correction for Illumina 16S and ITS amplicon reads. bioRxiv, 081257, doi: https://doi.org/10.1101/081257. Comparative Statistics Microsynth’s comparative statistical module requires an adequate experi - mental design including sample repli - cates and at least two conditions that can be compared (e.g. treatment versus control). To obtain statistically valid results, we recommend using at least three biological replicates per condi - tion. The analysis includes beta diver - sity calculations which are presented in various graphs including principal com - ponent analysis plots (see Figure 4A ) and network or tree graphs display - ing similarities and differences between the samples. The major outcome of this module is the identification of OTUs that are differentially abundant between the chosen conditions together with appro - priate statistical measures. The differen - tially abundant OTUs are summarized in an interactive table, allowing an easy identification of significant changes in an OTUs abundance (see Figure 4B ). Figure 4. Examples for beta diversity results. 4A. Principal component analysis plot to visualize sample clustering. 4B. This detail of a results table shows differential abundance of OTUs between two conditions, including statistical measures for differential abundance (log fold change) and significance (adjusted p-value). base - Mean: mean OTU size; lfcSE: standard error; stat: Wald statistic; p-value: Wald test p-value; padj: p-value adjusted for multiple testing. Other Analysis Possibilities for Microbial Communities For the analysis of the functional poten - tial of a microbial community, shotgun metagenomics is the method of choice. We offer a full shotgun metagenomics service providing you with full flexibil - ity regarding the analysis of your results. For further information see our shotgun metagenomics application note. In case you are interested in the actively expressed genes of a microbial commu - nity our shotgun metatranscriptomics service offers an appropriate solution.
         
        
                     !" #       $  % &  
'() *
+ *,  '*'-, *( - *

   
(' -
 *+)' *) )

*- *-' ,
*() (   ' *
)' *-,*'
*
( -
*
( -  , -'
 *
+) * ' )*
*) 


*)( 

 - -) *), *)((*+(
* , *-
   ' ,' * * 
*

' *' 
)
*' 
'  ) '- *-'+ *- ,' 
*' (*+ ) ,*+
'  + ( *- *-,-*+ *,- ) *)+ )
                   


       Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing